Review



bioid2  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc bioid2
    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with <t>BioID2</t> on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Bioid2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bioid2+ha/MCS-13X+Linker-BioID2-HA+(Plasmid+%2380899)/pmc12922663-378-6-8
    Average 93 stars, based on 33 article reviews
    bioid2 - by Bioz Stars, 2026-10
    93/100 stars

    Images

    1) Product Images from "A PI3Kδ-Foxo1-FasL signaling amplification loop rewires CD4 + T cell signaling and differentiation"

    Article Title: A PI3Kδ-Foxo1-FasL signaling amplification loop rewires CD4 + T cell signaling and differentiation

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20252154

    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with BioID2 on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Figure Legend Snippet: Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with BioID2 on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.

    Techniques Used: Activation Assay, Flow Cytometry, Staining, Stable Transfection, Cell Culture, Recombinant, Expressing, Control, Mass Spectrometry, Negative Control

    Related Articles

    Over Expression:

    Article Title: Protein O-GlcNAcylation and hexokinase mitochondrial dissociation drive heart failure with preserved ejection fraction.
    Article Snippet: In brief Tatekoshi et al. describe that hexokinase (HK) 1 mitochondrial dislocation drives endothelial dysfunction and heart failure with preserved ejection fraction (HFpEF).. HK1 subcellular localization regulates the supply of hexosamine biosynthetic pathway products, balancing N-glycosylation and O-GlcNAcylation.. Inhibition of O-linked Nacetylglucosamine-transferase (OGT) with 5S-GlcNHex mitigates HFpEF, highlighting a potential therapeutic strategy.

    Construct:

    Article Title: Protein O-GlcNAcylation and hexokinase mitochondrial dissociation drive heart failure with preserved ejection fraction.
    Article Snippet: In brief Tatekoshi et al. describe that hexokinase (HK) 1 mitochondrial dislocation drives endothelial dysfunction and heart failure with preserved ejection fraction (HFpEF).. HK1 subcellular localization regulates the supply of hexosamine biosynthetic pathway products, balancing N-glycosylation and O-GlcNAcylation.. Inhibition of O-linked Nacetylglucosamine-transferase (OGT) with 5S-GlcNHex mitigates HFpEF, highlighting a potential therapeutic strategy.

    Article Title: Hexokinase-1 mitochondrial dissociation and protein O-GlcNAcylation drive heart failure with preserved ejection fraction
    Article Snippet: .. To produce constructs for overexpressing FL-HK1-BioID2-HA and Tr-HK1BioID2-HA, PCR fragments of BioID2-HA were obtained from MCS-BioID2-HA plasmid (#74224, Addgene) using primers with a 15-bp homology portion to the 3’-end of either FL-HK1 or Tr-HK1 just before the stop codon of the genes to facilitate recombination with In-Fusion (Takara Bio) reaction. .. Production of lentiviruses and stably overexpressing HUVECs To overexpress the gene of interest, HUVECs within passage number of 3 in a 35 mm-well were incubated with 25 μl of concentrated viruses, 775 μl of EGM2, and 0.8 μl of polybrene (Millipore Sigma) for 8 hours, followed by addition of 1 ml of EGM2 media and incubation for another 16 hrs.

    Produced:

    Article Title: Protein O-GlcNAcylation and hexokinase mitochondrial dissociation drive heart failure with preserved ejection fraction.
    Article Snippet: In brief Tatekoshi et al. describe that hexokinase (HK) 1 mitochondrial dislocation drives endothelial dysfunction and heart failure with preserved ejection fraction (HFpEF).. HK1 subcellular localization regulates the supply of hexosamine biosynthetic pathway products, balancing N-glycosylation and O-GlcNAcylation.. Inhibition of O-linked Nacetylglucosamine-transferase (OGT) with 5S-GlcNHex mitigates HFpEF, highlighting a potential therapeutic strategy.

    Polymerase Chain Reaction:

    Article Title: Protein O-GlcNAcylation and hexokinase mitochondrial dissociation drive heart failure with preserved ejection fraction.
    Article Snippet: In brief Tatekoshi et al. describe that hexokinase (HK) 1 mitochondrial dislocation drives endothelial dysfunction and heart failure with preserved ejection fraction (HFpEF).. HK1 subcellular localization regulates the supply of hexosamine biosynthetic pathway products, balancing N-glycosylation and O-GlcNAcylation.. Inhibition of O-linked Nacetylglucosamine-transferase (OGT) with 5S-GlcNHex mitigates HFpEF, highlighting a potential therapeutic strategy.

    Article Title: Hexokinase-1 mitochondrial dissociation and protein O-GlcNAcylation drive heart failure with preserved ejection fraction
    Article Snippet: .. To produce constructs for overexpressing FL-HK1-BioID2-HA and Tr-HK1BioID2-HA, PCR fragments of BioID2-HA were obtained from MCS-BioID2-HA plasmid (#74224, Addgene) using primers with a 15-bp homology portion to the 3’-end of either FL-HK1 or Tr-HK1 just before the stop codon of the genes to facilitate recombination with In-Fusion (Takara Bio) reaction. .. Production of lentiviruses and stably overexpressing HUVECs To overexpress the gene of interest, HUVECs within passage number of 3 in a 35 mm-well were incubated with 25 μl of concentrated viruses, 775 μl of EGM2, and 0.8 μl of polybrene (Millipore Sigma) for 8 hours, followed by addition of 1 ml of EGM2 media and incubation for another 16 hrs.

    Plasmid Preparation:

    Article Title: Protein O-GlcNAcylation and hexokinase mitochondrial dissociation drive heart failure with preserved ejection fraction.
    Article Snippet: In brief Tatekoshi et al. describe that hexokinase (HK) 1 mitochondrial dislocation drives endothelial dysfunction and heart failure with preserved ejection fraction (HFpEF).. HK1 subcellular localization regulates the supply of hexosamine biosynthetic pathway products, balancing N-glycosylation and O-GlcNAcylation.. Inhibition of O-linked Nacetylglucosamine-transferase (OGT) with 5S-GlcNHex mitigates HFpEF, highlighting a potential therapeutic strategy.

    Article Title: Proximity-dependent Proteomics Reveals Extensive Interactions of Protocadherin-19 with Regulators of Rho GTPases and the Microtubule Cytoskeleton.
    Article Snippet: .. The coding sequences for BioID-HA and BioID2-HA were obtained from Addgene (www.addgene.org). pcDNA3.1 MCS-BirA(R118G)-HA was a gift from Kyle Roux (Addgene plasmid #36047 ; http://n2t.net/addgene:36047; RRID:Addgene_36047), and MCS-BioID2-HA was a gift from Kyle Roux (Addgene plasmid #74224; http://n2t.net/addgene:74224 ; RRID:Addgene_74224). ..

    Article Title: Hexokinase-1 mitochondrial dissociation and protein O-GlcNAcylation drive heart failure with preserved ejection fraction
    Article Snippet: .. To produce constructs for overexpressing FL-HK1-BioID2-HA and Tr-HK1BioID2-HA, PCR fragments of BioID2-HA were obtained from MCS-BioID2-HA plasmid (#74224, Addgene) using primers with a 15-bp homology portion to the 3’-end of either FL-HK1 or Tr-HK1 just before the stop codon of the genes to facilitate recombination with In-Fusion (Takara Bio) reaction. .. Production of lentiviruses and stably overexpressing HUVECs To overexpress the gene of interest, HUVECs within passage number of 3 in a 35 mm-well were incubated with 25 μl of concentrated viruses, 775 μl of EGM2, and 0.8 μl of polybrene (Millipore Sigma) for 8 hours, followed by addition of 1 ml of EGM2 media and incubation for another 16 hrs.

    Article Title: CNS-infecting pathogens Escherichia coli and Cryptococcus neoformans exploit the host Pdlim2 for intracellular traversal and exocytosis in the blood-brain barrier
    Article Snippet: .. BioID2-HA was amplified from plasmid MCS-BioID2HA (74224; Addgene) with primers BioID2-HA-F (CTGCCACCCTCAGCTCTCGGGCCCGCTTAAGGCCTGTTA ACCGG) and BioID2-HA-R (GCAGAGAGAAGTTTGTTGCGCCGGATCCTGCGTAATCCGGTACATCGTAAGGG) (27). .. To generate LentiPdlim2-BioID2-HA cells, the PDLIM2 cDNA and BioID2-HA PCR fragments were assembled into XbaI- and BamHI-linearized lentiCas9-Blast (52962; Addgene) using the NEBuilder hifi DNA assembly kit.

    Article Title: Central Nervous System-Infecting Pathogens Escherichia coli and Cryptococcus neoformans Exploit the Host Pdlim2 for Intracellular Traversal and Exocytosis in the Blood-Brain Barrier.
    Article Snippet: .. BioID2-HA was amplified from plasmid MCS-BioID2HA (74224; Addgene) with primers BioID2-HA-F (CTGCCACCCTCAGCTCTCGGGCCCGCTTAAGGCCTGTTA ACCGG) and BioID2-HA-R (GCAGAGAGAAGTTTGTTGCGCCGGATCCTGCGTAATCCGGTACATCGTAAGGG) (27). .. To generate LentiPdlim2-BioID2-HA cells, the PDLIM2 cDNA and BioID2-HA PCR fragments were assembled into XbaI- and BamHI-linearized lentiCas9-Blast (52962; Addgene) using the NEBuilder hifi DNA assembly kit.

    Article Title: Extended-Synaptotagmin 1 Enhances Liver Cancer Progression Mediated by the Unconventional Secretion of Cytosolic Proteins
    Article Snippet: Plasmids. pEGFP-C1-EGFP-ESYT1 (plasmid no. 66830), pHRm-NLS-sCas9-GFP 11 × 7-NLS (plasmid no. 70224), and pHRm-GFP 1–10 -VP64-NLS (plasmid no. 70228) were purchased from Addgene (Cambridge, MA, USA). .. BioID2-HA was cloned from the MCS-BioID2-HA plasmid (Addgene plasmid no.74224), followed by a 13 × GSGSGS (13 × GS) linker attached to the C terminus of PRKCD (PKCδ) to generate PKCδ-13 × GS-BioID2 in the pTRE vector. .. For split-GFP fusions, regions of PKCδ-13 × GS-GFP 11 -V5 and GFP 1–10 -HA-E-Syt1 were amplified and cloned into pTRE using a DNA Assembly kit (NEB, MA, USA).

    Amplification:

    Article Title: CNS-infecting pathogens Escherichia coli and Cryptococcus neoformans exploit the host Pdlim2 for intracellular traversal and exocytosis in the blood-brain barrier
    Article Snippet: .. BioID2-HA was amplified from plasmid MCS-BioID2HA (74224; Addgene) with primers BioID2-HA-F (CTGCCACCCTCAGCTCTCGGGCCCGCTTAAGGCCTGTTA ACCGG) and BioID2-HA-R (GCAGAGAGAAGTTTGTTGCGCCGGATCCTGCGTAATCCGGTACATCGTAAGGG) (27). .. To generate LentiPdlim2-BioID2-HA cells, the PDLIM2 cDNA and BioID2-HA PCR fragments were assembled into XbaI- and BamHI-linearized lentiCas9-Blast (52962; Addgene) using the NEBuilder hifi DNA assembly kit.

    Article Title: Central Nervous System-Infecting Pathogens Escherichia coli and Cryptococcus neoformans Exploit the Host Pdlim2 for Intracellular Traversal and Exocytosis in the Blood-Brain Barrier.
    Article Snippet: .. BioID2-HA was amplified from plasmid MCS-BioID2HA (74224; Addgene) with primers BioID2-HA-F (CTGCCACCCTCAGCTCTCGGGCCCGCTTAAGGCCTGTTA ACCGG) and BioID2-HA-R (GCAGAGAGAAGTTTGTTGCGCCGGATCCTGCGTAATCCGGTACATCGTAAGGG) (27). .. To generate LentiPdlim2-BioID2-HA cells, the PDLIM2 cDNA and BioID2-HA PCR fragments were assembled into XbaI- and BamHI-linearized lentiCas9-Blast (52962; Addgene) using the NEBuilder hifi DNA assembly kit.

    Clone Assay:

    Article Title: Extended-Synaptotagmin 1 Enhances Liver Cancer Progression Mediated by the Unconventional Secretion of Cytosolic Proteins
    Article Snippet: Plasmids. pEGFP-C1-EGFP-ESYT1 (plasmid no. 66830), pHRm-NLS-sCas9-GFP 11 × 7-NLS (plasmid no. 70224), and pHRm-GFP 1–10 -VP64-NLS (plasmid no. 70228) were purchased from Addgene (Cambridge, MA, USA). .. BioID2-HA was cloned from the MCS-BioID2-HA plasmid (Addgene plasmid no.74224), followed by a 13 × GSGSGS (13 × GS) linker attached to the C terminus of PRKCD (PKCδ) to generate PKCδ-13 × GS-BioID2 in the pTRE vector. .. For split-GFP fusions, regions of PKCδ-13 × GS-GFP 11 -V5 and GFP 1–10 -HA-E-Syt1 were amplified and cloned into pTRE using a DNA Assembly kit (NEB, MA, USA).

    other:

    Article Title: Extended-synaptotagmin 1 engages in unconventional protein secretion mediated via SEC22B + vesicle pathway in liver cancer
    Article Snippet: pcDNA3.1-mCherry-hLC3B (plasmid no.40827), and pEGFP-C1-EGFP-ESYT1 (plasmid no. 66830) were purchased from Addgene (MA, USA).



    Similar Products

    bioid2  (Addgene inc)
    93
    Addgene inc bioid2
    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with <t>BioID2</t> on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Bioid2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bioid2+ha/MCS-13X+Linker-BioID2-HA+(Plasmid+%2380899)/pmc12922663-378-6-8
    Average 93 stars, based on 1 article reviews
    bioid2 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mcs bioid2 ha plasmid  (Addgene inc)
    95
    Addgene inc mcs bioid2 ha plasmid
    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with <t>BioID2</t> on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Mcs Bioid2 Ha Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bioid2+ha/MCS-BioID2-HA+(Plasmid+%2374224)/pm41706164-250-7-15
    Average 95 stars, based on 1 article reviews
    mcs bioid2 ha plasmid - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    bioid2 ha cds  (Addgene inc)
    93
    Addgene inc bioid2 ha cds
    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with <t>BioID2</t> on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Bioid2 Ha Cds, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bioid2+ha/MCS-13X+Linker-BioID2-HA+(Plasmid+%2380899)/bio_rxiv__64898__2026__02__09__704693-71-1-5
    Average 93 stars, based on 1 article reviews
    bioid2 ha cds - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mcs bioid2 ha  (Addgene inc)
    95
    Addgene inc mcs bioid2 ha
    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with <t>BioID2</t> on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Mcs Bioid2 Ha, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bioid2+ha/MCS-BioID2-HA+(Plasmid+%2374224)/pm41641743-341-5-6
    Average 95 stars, based on 1 article reviews
    mcs bioid2 ha - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    mcs bioid2 ha vector  (Addgene inc)
    95
    Addgene inc mcs bioid2 ha vector
    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with <t>BioID2</t> on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Mcs Bioid2 Ha Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bioid2+ha/MCS-BioID2-HA+(Plasmid+%2374224)/pmc13042807-215-7-16
    Average 95 stars, based on 1 article reviews
    mcs bioid2 ha vector - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    pcdna 3 1 mcs bioid2 ha  (Addgene inc)
    95
    Addgene inc pcdna 3 1 mcs bioid2 ha
    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with <t>BioID2</t> on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Pcdna 3 1 Mcs Bioid2 Ha, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bioid2+ha/MCS-BioID2-HA+(Plasmid+%2374224)/pmc12824170-2-0-4
    Average 95 stars, based on 1 article reviews
    pcdna 3 1 mcs bioid2 ha - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    pcdna3 1 mcs bioid2 ha  (Addgene inc)
    95
    Addgene inc pcdna3 1 mcs bioid2 ha
    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with <t>BioID2</t> on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.
    Pcdna3 1 Mcs Bioid2 Ha, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bioid2+ha/MCS-BioID2-HA+(Plasmid+%2374224)/pmc12718141-254-21-26
    Average 95 stars, based on 1 article reviews
    pcdna3 1 mcs bioid2 ha - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with BioID2 on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.

    Journal: The Journal of Experimental Medicine

    Article Title: A PI3Kδ-Foxo1-FasL signaling amplification loop rewires CD4 + T cell signaling and differentiation

    doi: 10.1084/jem.20252154

    Figure Lengend Snippet: Fas-induced T cell activation occurs in the absence of FADD. (A) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions in the presence or absence of FasL-LZ (25 ng/ml). Top: Representative flow cytometry histograms showing pS6(S240/44) staining in live CD4 + cells. Bottom: Fold induction of pS6(S240/44) in Th2-polarized (−/+ FasL-LZ) live CD4 + T cells. Fold induction was calculated by normalizing MFIs to NC WT cells. n = 4–5 for each group, from four to five independent experiments. (B and C) Naïve CD4 T cells from WT and Pik3cd E1020K/+ mice were nucleofected with Cas9-gRNA complexes containing NC or Fadd -targeting gRNAs and polarized under Th2 conditions. n = 6 for each group, from six independent experiments. (B) Frequencies of IFNγ + Th2-polarized cells. (C) Th2-polarized cells were gated as FasL low , FasL mid , and FasL high . Frequencies of IFNγ + cells were measured in the indicated groups. (D–G) Fas was tagged with BioID2 on its intracellular C terminus (Fas-BioID) and stably expressed in Fas-deficient Jurkat cells. Fas-BioID Jurkat cells were cultured in the presence or absence of recombinant multimeric FasL (FasL-LZ). Jurkat cells expressing BioID alone were used as a control. (D) Venn diagram showing proteins identified following mass spectrometry analysis of biotinylated proteins (streptavidin pull-down) that were common between or specific to BioID-alone Jurkat cells versus Fas-BioID + FasL-LZ (P < 0.05, n = 3 for all groups). (E) Heatmap (row z-score) showing % normalized spectral abundance of proteins specifically upregulated in Fas-BioID ± FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells. (F) Pathway enrichment of Reactome gene sets was performed using Enrichr , with significantly enriched gene sets colored in blue; proteins specifically upregulated in Fas-BioID + FasL-LZ Jurkat cells relative to BioID-alone Jurkat cells were used as input for pathway enrichment. (G) Normalized spectral abundance (%) of the indicated proteins in BioID-alone, Fas-BioID, and Fas-BioID + FasL-LZ Jurkat cells, measured by mass spectrometry. Statistical comparisons were made using ratio paired t tests (G). *P < 0.05, **P < 0.01. NC, negative control.

    Article Snippet: Human Fas coding sequencing tagged with BioID2 (#80899; Addgene) and P2A-EGFP at the C terminus was subcloned into the pMY retroviral backbone (#163361; Addgene) using the Gibson assembly.

    Techniques: Activation Assay, Flow Cytometry, Staining, Stable Transfection, Cell Culture, Recombinant, Expressing, Control, Mass Spectrometry, Negative Control